Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102301 |
| Name | oriT_PEC-VIM|punnamed2  |
| Organism | Klebsiella pneumoniae strain PEC-VIM |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QHMM01000034 (1620..1668 [+], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_PEC-VIM|punnamed2
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2745 | GenBank | NZ_QHMM01000034 |
| Plasmid name | PEC-VIM|punnamed2 | Incompatibility group | IncFIB |
| Plasmid size | 29509 bp | Coordinate of oriT [Strand] | 1620..1668 [+] |
| Host baterium | Klebsiella pneumoniae strain PEC-VIM |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |