Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102298
Name   oriT_B15|unnamed P26 in_silico
Organism   Klebsiella pneumoniae strain B15
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_QWDG01000026 (1228..1277 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      6..12, 15..21  (CAAAATT..AATTTTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_B15|unnamed P26
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2742 GenBank   NZ_QWDG01000026
Plasmid name   B15|unnamed P26 Incompatibility group   Col440I
Plasmid size   4648 bp Coordinate of oriT [Strand]   1228..1277 [+]
Host baterium   Klebsiella pneumoniae strain B15

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -