Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102289
Name   oriT_SCPM-O-B-8470|unnamed in_silico
Organism   Staphylococcus aureus strain SCPM-O-B-8470
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_SDWR01000030 (915..1092 [+], 178 nt)
oriT length   178 nt
IRs (inverted repeats)      152..157, 167..172  (ATTTTA..TAAAAT)
 106..112, 119..125  (TCCCCAT..ATGGGGA)
 89..95, 99..105  (ATCTGGC..GCCAGAT)
 21..28, 33..40  (GTGTCACA..TGTGACAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 178 nt

>oriT_SCPM-O-B-8470|unnamed
TGTGACAAACGCAATATATTGTGTCACAAAACTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATTCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2733 GenBank   NZ_SDWR01000030
Plasmid name   SCPM-O-B-8470|unnamed Incompatibility group   -
Plasmid size   17312 bp Coordinate of oriT [Strand]   915..1092 [+]
Host baterium   Staphylococcus aureus strain SCPM-O-B-8470

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21