Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102281
Name   oriT_SCPM-O-B-8476|unnamed in_silico
Organism   Staphylococcus aureus strain SCPM-O-B-8476
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_SDWQ01000011 (1027..1216 [+], 190 nt)
oriT length   190 nt
IRs (inverted repeats)      133..139, 143..149  (GTCTGGC..GCCAGAC)
 4..11, 23..30  (CTTTTTTA..TAAAAAAG)
 16..21, 24..29  (TTTTTT..AAAAAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 190 nt

>oriT_SCPM-O-B-8476|unnamed
TGTCTTTTTTATTGATTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATTATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2725 GenBank   NZ_SDWQ01000011
Plasmid name   SCPM-O-B-8476|unnamed Incompatibility group   -
Plasmid size   3562 bp Coordinate of oriT [Strand]   1027..1216 [+]
Host baterium   Staphylococcus aureus strain SCPM-O-B-8476

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -