Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102280 |
| Name | oriT_KPN_KPC_HUG_02|p2  |
| Organism | Klebsiella pneumoniae strain KPN_KPC_HUG_02 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QRAD01000127 (10638..10687 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN_KPC_HUG_02|p2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1..11245
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DWR55_RS29400 (DWR55_29390) | 1..1880 | - | 1880 | WP_115064913 | TraC family protein | virb4 |
| DWR55_RS29405 (DWR55_29395) | 1952..2350 | - | 399 | WP_011977783 | hypothetical protein | - |
| DWR55_RS29410 (DWR55_29400) | 2358..2747 | - | 390 | WP_004153076 | hypothetical protein | - |
| DWR55_RS29415 (DWR55_29405) | 2790..3194 | - | 405 | WP_004152503 | hypothetical protein | - |
| DWR55_RS29420 (DWR55_29410) | 3261..3572 | - | 312 | WP_004152502 | hypothetical protein | - |
| DWR55_RS29425 (DWR55_29415) | 3573..3791 | - | 219 | WP_004152501 | hypothetical protein | - |
| DWR55_RS29430 (DWR55_29420) | 3897..4307 | - | 411 | WP_004152499 | hypothetical protein | - |
| DWR55_RS29435 (DWR55_29425) | 4439..5023 | - | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| DWR55_RS29440 (DWR55_29430) | 5137..6561 | - | 1425 | WP_004155033 | F-type conjugal transfer pilus assembly protein TraB | traB |
| DWR55_RS29445 (DWR55_29435) | 6561..7301 | - | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| DWR55_RS29450 (DWR55_29440) | 7288..7854 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| DWR55_RS29455 (DWR55_29445) | 7874..8179 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| DWR55_RS29460 (DWR55_29450) | 8193..8561 | - | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| DWR55_RS29465 (DWR55_29455) | 8615..9001 | - | 387 | WP_004152495 | TraY domain-containing protein | - |
| DWR55_RS29470 (DWR55_29460) | 9080..9766 | - | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| DWR55_RS29475 (DWR55_29465) | 9940..10338 | - | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| DWR55_RS29480 (DWR55_29470) | 10760..11245 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| DWR55_RS29485 (DWR55_29475) | 11278..11607 | - | 330 | WP_011977736 | DUF5983 family protein | - |
Host bacterium
| ID | 2724 | GenBank | NZ_QRAD01000127 |
| Plasmid name | KPN_KPC_HUG_02|p2 | Incompatibility group | - |
| Plasmid size | 11696 bp | Coordinate of oriT [Strand] | 10638..10687 [+] |
| Host baterium | Klebsiella pneumoniae strain KPN_KPC_HUG_02 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |