Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102279
Name   oriT_KPN_KPC_HUG_02|p1 in_silico
Organism   Klebsiella pneumoniae strain KPN_KPC_HUG_02
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_QRAD01000116 (2231..2280 [+], 50 nt)
oriT length   50 nt
IRs (inverted repeats)      7..14, 17..24  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 50 nt

>oriT_KPN_KPC_HUG_02|p1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2723 GenBank   NZ_QRAD01000116
Plasmid name   KPN_KPC_HUG_02|p1 Incompatibility group   -
Plasmid size   4588 bp Coordinate of oriT [Strand]   2231..2280 [+]
Host baterium   Klebsiella pneumoniae strain KPN_KPC_HUG_02

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -