Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102276 |
| Name | oriT_pB04 P9  |
| Organism | Klebsiella pneumoniae strain B04 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTGK01000095 (2463..2622 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_pB04 P9
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2720 | GenBank | NZ_NTGK01000095 |
| Plasmid name | pB04 P9 | Incompatibility group | IncQ1 |
| Plasmid size | 7178 bp | Coordinate of oriT [Strand] | 2463..2622 [-] |
| Host baterium | Klebsiella pneumoniae strain B04 |
Cargo genes
| Drug resistance gene | aph(3')-VIa |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |