Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102272 |
| Name | oriT_B8S35|unnamed2  |
| Organism | Klebsiella pneumoniae strain B8S35 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QKRJ01000068 (534..591 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_B8S35|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2716 | GenBank | NZ_QKRJ01000068 |
| Plasmid name | B8S35|unnamed2 | Incompatibility group | Col440II |
| Plasmid size | 3300 bp | Coordinate of oriT [Strand] | 534..591 [+] |
| Host baterium | Klebsiella pneumoniae strain B8S35 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |