Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102266 |
| Name | oriT_KPN_KPC_HUG_07|p2 |
| Organism | Klebsiella pneumoniae strain KPN_KPC_HUG_07 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_QRAH01000114 (556..605 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN_KPC_HUG_07|p2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1..6804
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DWR61_RS29030 (DWR61_29030) | 1..483 | - | 483 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| DWR61_RS29035 (DWR61_29035) | 905..1303 | + | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| DWR61_RS29040 (DWR61_29040) | 1477..2163 | + | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| DWR61_RS29045 (DWR61_29045) | 2242..2628 | + | 387 | WP_004152495 | TraY domain-containing protein | - |
| DWR61_RS29050 (DWR61_29050) | 2682..3050 | + | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| DWR61_RS29055 (DWR61_29055) | 3064..3369 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| DWR61_RS29060 (DWR61_29060) | 3389..3955 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| DWR61_RS29065 (DWR61_29065) | 3942..4682 | + | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| DWR61_RS29070 (DWR61_29070) | 4682..6106 | + | 1425 | WP_004155033 | F-type conjugal transfer pilus assembly protein TraB | traB |
| DWR61_RS29075 (DWR61_29075) | 6220..6804 | + | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| DWR61_RS29080 (DWR61_29080) | 6936..7346 | + | 411 | WP_004152499 | hypothetical protein | - |
| DWR61_RS30820 | 7452..7518 | + | 67 | Protein_11 | hypothetical protein | - |
Host bacterium
| ID | 2710 | GenBank | NZ_QRAH01000114 |
| Plasmid name | KPN_KPC_HUG_07|p2 | Incompatibility group | - |
| Plasmid size | 7518 bp | Coordinate of oriT [Strand] | 556..605 [-] |
| Host baterium | Klebsiella pneumoniae strain KPN_KPC_HUG_07 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |