Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102264 |
| Name | oriT_B30|unnamed  |
| Organism | Klebsiella pneumoniae strain B30 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NTHX01000097 (619..778 [-], 160 nt) |
| oriT length | 160 nt |
| IRs (inverted repeats) | 39..44, 48..53 (CCCTAC..GTAGGG) 6..12, 16..22 (GTTTCTC..GAGAAAC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GTGCGCCCTC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 160 nt
>oriT_B30|unnamed
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
GGCCAGTTTCTCGAAGAGAAACCGGTAAGTGCGCCCTCCCCTACAAAGTAGGGTCGGGATTGCCGCCGCTGTGCCTCCATGATAGCCTACGAGACAGCACATTAACAATGGGGTGTCAAGATGGTTAAGGGGAGCAACAAGGCGGCGGATCGGCTGGCCA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2708 | GenBank | NZ_NTHX01000097 |
| Plasmid name | B30|unnamed | Incompatibility group | IncQ1 |
| Plasmid size | 7251 bp | Coordinate of oriT [Strand] | 619..778 [-] |
| Host baterium | Klebsiella pneumoniae strain B30 |
Cargo genes
| Drug resistance gene | rmtG |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |