Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102224 |
| Name | oriT_BD13582|unnamed5  |
| Organism | Staphylococcus aureus strain BD13582 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LLBH01000022 (7482..7670 [+], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 71..76, 88..93 (AAAAGC..GCTTTT) 64..70, 77..83 (GTGTCAC..GTGACAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_BD13582|unnamed5
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2668 | GenBank | NZ_LLBH01000022 |
| Plasmid name | BD13582|unnamed5 | Incompatibility group | - |
| Plasmid size | 14365 bp | Coordinate of oriT [Strand] | 7482..7670 [+] |
| Host baterium | Staphylococcus aureus strain BD13582 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | sed |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |