Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102197
Name   oriT_SCPM-O-B-8378|unnamed in_silico
Organism   Staphylococcus argenteus strain SCPM-O-B-8378
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_PXXP01000014 (19145..19333 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      163..168, 178..183  (ATTTTA..TAAAAT)
 118..123, 130..135  (CCCCAT..ATGGGG)
 41..46, 48..53  (AAGTGT..ACACTT)
 31..39, 44..52  (AGTGTCACA..TGTGACACT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_SCPM-O-B-8378|unnamed
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGCCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2641 GenBank   NZ_PXXP01000014
Plasmid name   SCPM-O-B-8378|unnamed Incompatibility group   -
Plasmid size   23992 bp Coordinate of oriT [Strand]   19145..19333 [+]
Host baterium   Staphylococcus argenteus strain SCPM-O-B-8378

Cargo genes


Drug resistance gene   blaZ
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -