Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102156 |
| Name | oriT_UCI 32|unnamed3  |
| Organism | Staphylococcus aureus strain UCI 32 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LKZX01000183 (3709..3897 [-], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 71..76, 88..93 (AAAAGC..GCTTTT) 64..70, 77..83 (GTGTCAC..GTGACAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_UCI 32|unnamed3
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2600 | GenBank | NZ_LKZX01000183 |
| Plasmid name | UCI 32|unnamed3 | Incompatibility group | - |
| Plasmid size | 8034 bp | Coordinate of oriT [Strand] | 3709..3897 [-] |
| Host baterium | Staphylococcus aureus strain UCI 32 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIIA21 |