Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102138 |
| Name | oriT_ISU 880|unnamed1  |
| Organism | Staphylococcus aureus strain ISU 880 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LKWC01000066 (185..220 [+], 36 nt) |
| oriT length | 36 nt |
| IRs (inverted repeats) | 4..10, 14..20 (GCGAACG..CGTTCGC) |
| Location of nic site | 29..30 |
| Conserved sequence flanking the nic site |
GTGCGCCCTT |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 36 nt
>oriT_ISU 880|unnamed1
CACGCGAACGGAACGTTCGCATAAGTGCGCCCTTAC
CACGCGAACGGAACGTTCGCATAAGTGCGCCCTTAC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2582 | GenBank | NZ_LKWC01000066 |
| Plasmid name | ISU 880|unnamed1 | Incompatibility group | - |
| Plasmid size | 1579 bp | Coordinate of oriT [Strand] | 185..220 [+] |
| Host baterium | Staphylococcus aureus strain ISU 880 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |