Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102127 |
Name | oriT_ARPG-372|unnamed73 |
Organism | Klebsiella pneumoniae strain ARPG-372 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_NBOL01000123 (198..248 [+], 51 nt) |
oriT length | 51 nt |
IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_ARPG-372|unnamed73
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2571 | GenBank | NZ_NBOL01000123 |
Plasmid name | ARPG-372|unnamed73 | Incompatibility group | - |
Plasmid size | 739 bp | Coordinate of oriT [Strand] | 198..248 [+] |
Host baterium | Klebsiella pneumoniae strain ARPG-372 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |