Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102122 |
| Name | oriT_ARPG-372|unnamed33 |
| Organism | Klebsiella pneumoniae strain ARPG-372 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NBOL01000083 (543..593 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_ARPG-372|unnamed33
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2566 | GenBank | NZ_NBOL01000083 |
| Plasmid name | ARPG-372|unnamed33 | Incompatibility group | - |
| Plasmid size | 790 bp | Coordinate of oriT [Strand] | 543..593 [-] |
| Host baterium | Klebsiella pneumoniae strain ARPG-372 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |