Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102110 |
Name | oriT_UCI 18|unnamed4 |
Organism | Staphylococcus aureus strain UCI 18 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LKZJ01000120 (71..259 [+], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 149..156, 161..168 (CTATCATT..AATGATAG) 132..138, 142..148 (GTCTGGC..GCCAGAC) 71..76, 88..93 (AAAAGC..GCTTTT) 64..70, 77..83 (GTGTCAC..GTGACAC) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_UCI 18|unnamed4
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2554 | GenBank | NZ_LKZJ01000120 |
Plasmid name | UCI 18|unnamed4 | Incompatibility group | - |
Plasmid size | 20865 bp | Coordinate of oriT [Strand] | 71..259 [+] |
Host baterium | Staphylococcus aureus strain UCI 18 |
Cargo genes
Drug resistance gene | blaZ |
Virulence gene | sea |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |