Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102110
Name   oriT_UCI 18|unnamed4 in_silico
Organism   Staphylococcus aureus strain UCI 18
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LKZJ01000120 (71..259 [+], 189 nt)
oriT length   189 nt
IRs (inverted repeats)      149..156, 161..168  (CTATCATT..AATGATAG)
 132..138, 142..148  (GTCTGGC..GCCAGAC)
 71..76, 88..93  (AAAAGC..GCTTTT)
 64..70, 77..83  (GTGTCAC..GTGACAC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 189 nt

>oriT_UCI 18|unnamed4
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2554 GenBank   NZ_LKZJ01000120
Plasmid name   UCI 18|unnamed4 Incompatibility group   -
Plasmid size   20865 bp Coordinate of oriT [Strand]   71..259 [+]
Host baterium   Staphylococcus aureus strain UCI 18

Cargo genes


Drug resistance gene   blaZ
Virulence gene   sea
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -