Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102107 |
| Name | oriT_KPN_KPC_HUG_B3|p1  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain KPN_KPC_HUG_B3 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MUMU01000046 (1008..1057 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN_KPC_HUG_B3|p1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 450..12476
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| B0W92_RS28645 (B0W92_30005) | 88..417 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| B0W92_RS28650 (B0W92_30010) | 450..935 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| B0W92_RS28655 (B0W92_30015) | 1357..1755 | + | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| B0W92_RS28660 (B0W92_30020) | 1929..2615 | + | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| B0W92_RS28665 (B0W92_30025) | 2694..3080 | + | 387 | WP_004152495 | TraY domain-containing protein | - |
| B0W92_RS28670 (B0W92_30030) | 3134..3502 | + | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| B0W92_RS28675 (B0W92_30035) | 3516..3821 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| B0W92_RS28680 (B0W92_30040) | 3841..4407 | + | 567 | WP_015060016 | type IV conjugative transfer system protein TraE | traE |
| B0W92_RS28685 (B0W92_30045) | 4394..5134 | + | 741 | WP_004152601 | type-F conjugative transfer system secretin TraK | traK |
| B0W92_RS28690 (B0W92_30050) | 5134..6558 | + | 1425 | WP_004152600 | F-type conjugal transfer pilus assembly protein TraB | traB |
| B0W92_RS28695 (B0W92_30055) | 6551..7147 | + | 597 | WP_004152599 | conjugal transfer pilus-stabilizing protein TraP | - |
| B0W92_RS28700 (B0W92_30060) | 7170..7739 | + | 570 | WP_004152598 | type IV conjugative transfer system lipoprotein TraV | traV |
| B0W92_RS28705 (B0W92_30065) | 7871..8281 | + | 411 | WP_004152597 | lipase chaperone | - |
| B0W92_RS28710 (B0W92_30070) | 8286..8576 | + | 291 | WP_004152596 | hypothetical protein | - |
| B0W92_RS28715 (B0W92_30075) | 8600..8818 | + | 219 | WP_004171484 | hypothetical protein | - |
| B0W92_RS28720 (B0W92_30080) | 8819..9136 | + | 318 | WP_004152595 | hypothetical protein | - |
| B0W92_RS28725 (B0W92_30085) | 9203..9607 | + | 405 | WP_004152594 | hypothetical protein | - |
| B0W92_RS28735 (B0W92_30095) | 9903..10301 | + | 399 | WP_004153071 | hypothetical protein | - |
| B0W92_RS28740 (B0W92_30100) | 10373..12476 | + | 2104 | WP_004166266 | type IV secretion system protein TraC | virb4 |
Host bacterium
| ID | 2551 | GenBank | NZ_MUMU01000046 |
| Plasmid name | KPN_KPC_HUG_B3|p1 | Incompatibility group | - |
| Plasmid size | 12476 bp | Coordinate of oriT [Strand] | 1008..1057 [-] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain KPN_KPC_HUG_B3 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |