Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102106 |
| Name | oriT_UCI 63|unnamed3  |
| Organism | Staphylococcus aureus strain UCI 63 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LLBC01000092 (2016..2170 [-], 155 nt) |
| oriT length | 155 nt |
| IRs (inverted repeats) | 115..122, 127..134 (CTATCATT..AATGATAG) 98..104, 108..114 (GTCTGGC..GCCAGAC) 37..42, 54..59 (AAAAGC..GCTTTT) 30..36, 43..49 (GTGTCAC..GTGACAC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 155 nt
>oriT_UCI 63|unnamed3
TCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
TCTCAAAACTGTGACAACCGCAATATATTGTGTCACAAAAGCGTGACACTACAGCTTTTTATGATATCACTTTAAAATTACTTAAAACCCTTAGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTCTCCTTATGCTCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2550 | GenBank | NZ_LLBC01000092 |
| Plasmid name | UCI 63|unnamed3 | Incompatibility group | - |
| Plasmid size | 2170 bp | Coordinate of oriT [Strand] | 2016..2170 [-] |
| Host baterium | Staphylococcus aureus strain UCI 63 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |