Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   102093
Name   oriT_SCPM-O-DNA-13|pPCP1 in_silico
Organism   Yersinia pestis subsp. microtus strain SCPM-O-DNA-13
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_NHND01000116 (1379..1438 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_SCPM-O-DNA-13|pPCP1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2537 GenBank   NZ_NHND01000116
Plasmid name   SCPM-O-DNA-13|pPCP1 Incompatibility group   ColRNAI
Plasmid size   7970 bp Coordinate of oriT [Strand]   1379..1438 [+]
Host baterium   Yersinia pestis subsp. microtus strain SCPM-O-DNA-13

Cargo genes


Drug resistance gene   -
Virulence gene   pla
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -