Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102082 |
| Name | oriT_SCPM-O-DNA-05|pPCP1  |
| Organism | Yersinia pestis subsp. microtus bv. Altaica strain SCPM-O-DNA-05 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_NHYJ01000110 (6472..6531 [-], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_SCPM-O-DNA-05|pPCP1
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2526 | GenBank | NZ_NHYJ01000110 |
| Plasmid name | SCPM-O-DNA-05|pPCP1 | Incompatibility group | ColRNAI |
| Plasmid size | 7909 bp | Coordinate of oriT [Strand] | 6472..6531 [-] |
| Host baterium | Yersinia pestis subsp. microtus bv. Altaica strain SCPM-O-DNA-05 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | pla |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |