Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102071 |
| Name | oriT_KP41|unnamed1 KP41_62 |
| Organism | Klebsiella pneumoniae strain KP41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MOLX01000062 (1880..1937 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | 29..36, 39..46 (CACAGCGT..ACGCTGTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_KP41|unnamed1 KP41_62
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2515 | GenBank | NZ_MOLX01000062 |
| Plasmid name | KP41|unnamed1 KP41_62 | Incompatibility group | ColRNAI |
| Plasmid size | 5673 bp | Coordinate of oriT [Strand] | 1880..1937 [+] |
| Host baterium | Klebsiella pneumoniae strain KP41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |