Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102070 |
| Name | oriT_KP41|unnamed1 KP41_50  |
| Organism | Klebsiella pneumoniae strain KP41 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MOLX01000050 (7666..7789 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 101..106, 119..124 (TTTAAT..ATTAAA) 91..99, 113..121 (AATAATGTA..TACATTATT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_KP41|unnamed1 KP41_50
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGCTTTTTGAATCATTAGCTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATTAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 7094..15723
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BLJ97_RS27295 (BLJ97_27305) | 3066..3500 | + | 435 | WP_000845953 | conjugation system SOS inhibitor PsiB | - |
| BLJ97_RS27300 (BLJ97_27310) | 3497..4216 | + | 720 | WP_001276217 | plasmid SOS inhibition protein A | - |
| BLJ97_RS32115 | 4438..4587 | + | 150 | Protein_6 | plasmid maintenance protein Mok | - |
| BLJ97_RS30205 | 4529..4654 | + | 126 | WP_001372321 | type I toxin-antitoxin system Hok family toxin | - |
| BLJ97_RS31800 (BLJ97_27315) | 4973..5269 | - | 297 | Protein_8 | hypothetical protein | - |
| BLJ97_RS27310 (BLJ97_27320) | 5569..5865 | + | 297 | WP_001272251 | hypothetical protein | - |
| BLJ97_RS27315 (BLJ97_27325) | 5976..6797 | + | 822 | WP_001234445 | DUF932 domain-containing protein | - |
| BLJ97_RS27320 (BLJ97_27330) | 7094..7741 | - | 648 | WP_015059008 | transglycosylase SLT domain-containing protein | virB1 |
| BLJ97_RS27325 (BLJ97_27335) | 8018..8401 | + | 384 | WP_000124981 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| BLJ97_RS30225 | 8592..9278 | + | 687 | WP_015059009 | PAS domain-containing protein | - |
| BLJ97_RS30230 | 9372..9599 | + | 228 | WP_001254386 | conjugal transfer relaxosome protein TraY | - |
| BLJ97_RS27335 (BLJ97_27345) | 9633..9998 | + | 366 | WP_021519752 | type IV conjugative transfer system pilin TraA | - |
| BLJ97_RS27340 (BLJ97_27350) | 10013..10324 | + | 312 | WP_000012106 | type IV conjugative transfer system protein TraL | traL |
| BLJ97_RS27345 (BLJ97_27355) | 10346..10912 | + | 567 | WP_000399794 | type IV conjugative transfer system protein TraE | traE |
| BLJ97_RS27350 (BLJ97_27360) | 10899..11627 | + | 729 | WP_001230787 | type-F conjugative transfer system secretin TraK | traK |
| BLJ97_RS27355 (BLJ97_27365) | 11627..13054 | + | 1428 | WP_032297072 | F-type conjugal transfer pilus assembly protein TraB | traB |
| BLJ97_RS27360 (BLJ97_27370) | 13044..13634 | + | 591 | WP_000002778 | conjugal transfer pilus-stabilizing protein TraP | - |
| BLJ97_RS27365 (BLJ97_27375) | 13621..13818 | + | 198 | WP_001324648 | conjugal transfer protein TrbD | - |
| BLJ97_RS27370 (BLJ97_27380) | 13830..14081 | + | 252 | WP_001038341 | conjugal transfer protein TrbG | - |
| BLJ97_RS27375 (BLJ97_27385) | 14078..14593 | + | 516 | WP_062955122 | type IV conjugative transfer system lipoprotein TraV | traV |
| BLJ97_RS30235 | 14728..14949 | + | 222 | WP_001278692 | conjugal transfer protein TraR | - |
| BLJ97_RS30240 | 15109..15723 | + | 615 | WP_242427873 | TraC family protein | virb4 |
| BLJ97_RS27385 (BLJ97_27395) | 15614..15874 | - | 261 | WP_031970374 | DDE-type integrase/transposase/recombinase | - |
Host bacterium
| ID | 2514 | GenBank | NZ_MOLX01000050 |
| Plasmid name | KP41|unnamed1 KP41_50 | Incompatibility group | - |
| Plasmid size | 15874 bp | Coordinate of oriT [Strand] | 7666..7789 [+] |
| Host baterium | Klebsiella pneumoniae strain KP41 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |