Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 102060 |
Name | oriT_pSaa6159_like |
Organism | Staphylococcus aureus M1057 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_MPPG01000066 (2336..2524 [+], 189 nt) |
oriT length | 189 nt |
IRs (inverted repeats) | 163..168, 178..183 (ATTTTA..TAAAAT) 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) 41..46, 48..53 (AAGTGT..ACACTT) 31..39, 44..52 (AGTGTCACA..TGTGACACT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_pSaa6159_like
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2504 | GenBank | NZ_MPPG01000066 |
Plasmid name | pSaa6159_like | Incompatibility group | - |
Plasmid size | 6931 bp | Coordinate of oriT [Strand] | 2336..2524 [+] |
Host baterium | Staphylococcus aureus M1057 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |