Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 102058 |
| Name | oriT_kp10|unnamed1 KP10_55  |
| Organism | Klebsiella pneumoniae strain kp10 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MNCK01000054 (2826..2885 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_kp10|unnamed1 KP10_55
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2502 | GenBank | NZ_MNCK01000054 |
| Plasmid name | kp10|unnamed1 KP10_55 | Incompatibility group | Col440II |
| Plasmid size | 3829 bp | Coordinate of oriT [Strand] | 2826..2885 [+] |
| Host baterium | Klebsiella pneumoniae strain kp10 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |