Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101990
Name   oriT_SN0033_1|punknown1 in_silico
Organism   Salmonella enterica subsp. enterica serovar Newport strain SN0033_1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MBOU01000005 (18976..19080 [-], 105 nt)
oriT length   105 nt
IRs (inverted repeats)      56..61, 74..79  (TGGAAT..ATTCCA)
 46..51, 56..61  (ATTCCA..TGGAAT)
 1..6, 8..13  (AATTTG..CAAATT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 105 nt

>oriT_SN0033_1|punknown1
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2434 GenBank   NZ_MBOU01000005
Plasmid name   SN0033_1|punknown1 Incompatibility group   IncA/C2
Plasmid size   53011 bp Coordinate of oriT [Strand]   18976..19080 [-]
Host baterium   Salmonella enterica subsp. enterica serovar Newport strain SN0033_1

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   merR, merT, merP, merA, merB, merD, merE
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -