Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101978
Name   oriT_SE710A|unnamed1 in_silico
Organism   Salmonella enterica subsp. enterica strain SE710A
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LXGZ01000253 (33854..33958 [+], 105 nt)
oriT length   105 nt
IRs (inverted repeats)      56..61, 74..79  (TGGAAT..ATTCCA)
 46..51, 56..61  (ATTCCA..TGGAAT)
 1..6, 8..13  (AATTTG..CAAATT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 105 nt

>oriT_SE710A|unnamed1
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2422 GenBank   NZ_LXGZ01000253
Plasmid name   SE710A|unnamed1 Incompatibility group   IncA/C2
Plasmid size   40192 bp Coordinate of oriT [Strand]   33854..33958 [+]
Host baterium   Salmonella enterica subsp. enterica strain SE710A

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   merE, merD, merB, merA, merP, merT, merR
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -