Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101978 |
Name | oriT_SE710A|unnamed1 |
Organism | Salmonella enterica subsp. enterica strain SE710A |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LXGZ01000253 (33854..33958 [+], 105 nt) |
oriT length | 105 nt |
IRs (inverted repeats) | 56..61, 74..79 (TGGAAT..ATTCCA) 46..51, 56..61 (ATTCCA..TGGAAT) 1..6, 8..13 (AATTTG..CAAATT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 105 nt
>oriT_SE710A|unnamed1
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2422 | GenBank | NZ_LXGZ01000253 |
Plasmid name | SE710A|unnamed1 | Incompatibility group | IncA/C2 |
Plasmid size | 40192 bp | Coordinate of oriT [Strand] | 33854..33958 [+] |
Host baterium | Salmonella enterica subsp. enterica strain SE710A |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | merE, merD, merB, merA, merP, merT, merR |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |