Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101956 |
Name | oriT_UCI 21|unnamed2 |
Organism | Staphylococcus aureus strain UCI 21 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_LKZM01000061 (1455..1694 [+], 240 nt) |
oriT length | 240 nt |
IRs (inverted repeats) | 217..222, 232..237 (ATTTTA..TAAAAT) 171..178, 183..190 (CTATCATT..AATGATAG) 155..160, 164..169 (TCTGGC..GCCAGA) 26..32, 44..50 (TTTTTTA..TAAAAAA) 1..7, 20..26 (AAGACAT..ATGTCTT) |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 240 nt
>oriT_UCI 21|unnamed2
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2400 | GenBank | NZ_LKZM01000061 |
Plasmid name | UCI 21|unnamed2 | Incompatibility group | - |
Plasmid size | 20843 bp | Coordinate of oriT [Strand] | 1455..1694 [+] |
Host baterium | Staphylococcus aureus strain UCI 21 |
Cargo genes
Drug resistance gene | blaZ, mupA |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | AcrIIA21 |