Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101952
Name   oriT_UCI 19|unnamed6 in_silico
Organism   Staphylococcus aureus strain UCI 19
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LKZK01000089 (10820..11059 [-], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 155..160, 164..169  (TCTGGC..GCCAGA)
 26..32, 44..50  (TTTTTTA..TAAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT_UCI 19|unnamed6
AAGACATTAGTGATAACTGATGTCTTTTTTTATTGTTTTTCTGTAAAAAAGTGCTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATAACTTAAAACCCTTGGAATGTCTGGCCTTGCCAGATCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2396 GenBank   NZ_LKZK01000089
Plasmid name   UCI 19|unnamed6 Incompatibility group   -
Plasmid size   16830 bp Coordinate of oriT [Strand]   10820..11059 [-]
Host baterium   Staphylococcus aureus strain UCI 19

Cargo genes


Drug resistance gene   blaZ, mph(C)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21