Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101937 |
| Name | oriT_pKUFSE-SAL43-2  |
| Organism | Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-CM43 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAALJB010000003 (14551..14610 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pKUFSE-SAL43-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2381 | GenBank | NZ_JAALJB010000003 |
| Plasmid name | pKUFSE-SAL43-2 | Incompatibility group | Col440II |
| Plasmid size | 17723 bp | Coordinate of oriT [Strand] | 14551..14610 [+] |
| Host baterium | Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-CM43 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | arsH, arsR, arsB, arsC |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |