Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101937
Name   oriT_pKUFSE-SAL43-2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-CM43
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAALJB010000003 (14551..14610 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKUFSE-SAL43-2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2381 GenBank   NZ_JAALJB010000003
Plasmid name   pKUFSE-SAL43-2 Incompatibility group   Col440II
Plasmid size   17723 bp Coordinate of oriT [Strand]   14551..14610 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Dessau strain KUFSE-CM43

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   arsH, arsR, arsB, arsC
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -