Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101934
Name   oriT_B199|unnamed 5 in_silico
Organism   Klebsiella pneumoniae strain B199
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LJCB01000046 (1172..1227 [-], 56 nt)
oriT length   56 nt
IRs (inverted repeats)      29..36, 39..46  (CACAGCGT..ACGCTGTG)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 56 nt

>oriT_B199|unnamed 5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGCGTTTACGCTGTGTATACTGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2378 GenBank   NZ_LJCB01000046
Plasmid name   B199|unnamed 5 Incompatibility group   ColRNAI
Plasmid size   5834 bp Coordinate of oriT [Strand]   1172..1227 [-]
Host baterium   Klebsiella pneumoniae strain B199

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -