Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101932
Name   oriT_SMo01|unnamed2 in_silico
Organism   Salmonella enterica subsp. enterica serovar Montevideo strain SMo01
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_MATD01000023 (2668..2727 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_SMo01|unnamed2
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2376 GenBank   NZ_MATD01000023
Plasmid name   SMo01|unnamed2 Incompatibility group   Col440II
Plasmid size   5537 bp Coordinate of oriT [Strand]   2668..2727 [+]
Host baterium   Salmonella enterica subsp. enterica serovar Montevideo strain SMo01

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -