Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101923
Name   oriT_A5Z878|unnamed in_silico
Organism   Vibrio parahaemolyticus strain A5Z878
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LQCT01000028 (142..241 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_A5Z878|unnamed
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2367 GenBank   NZ_LQCT01000028
Plasmid name   A5Z878|unnamed Incompatibility group   -
Plasmid size   1068 bp Coordinate of oriT [Strand]   142..241 [+]
Host baterium   Vibrio parahaemolyticus strain A5Z878

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -