Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101920 |
| Name | oriT_IA565|unnamed s1_R1-denovo_c48  |
| Organism | Klebsiella pneumoniae strain IA565 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JPIQ01000066 (2157..2206 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_IA565|unnamed s1_R1-denovo_c48
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2364 | GenBank | NZ_JPIQ01000066 |
| Plasmid name | IA565|unnamed s1_R1-denovo_c48 | Incompatibility group | - |
| Plasmid size | 4038 bp | Coordinate of oriT [Strand] | 2157..2206 [+] |
| Host baterium | Klebsiella pneumoniae strain IA565 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |