Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101914 |
| Name | oriT_A4|unnamed 1  |
| Organism | Staphylococcus aureus strain A4 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_LDVE01000059 (9421..9609 [-], 189 nt) |
| oriT length | 189 nt |
| IRs (inverted repeats) | 163..168, 178..183 (ATTTTA..TAAAAT) 118..123, 130..135 (CCCCAT..ATGGGG) 100..106, 110..116 (ATCTGGC..GCCAGAT) 41..46, 48..53 (AAGTGT..ACACTT) 31..39, 44..52 (AGTGTCACA..TGTGACACT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 189 nt
>oriT_A4|unnamed 1
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
TGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTTGAGCTTTTTATGACCCCACACAAAAACATTTTCGAAGCCTTGAAATATCTGGCTTTGCCAGATCCCCCATTCATTGATGGGGACAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTCTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2358 | GenBank | NZ_LDVE01000059 |
| Plasmid name | A4|unnamed 1 | Incompatibility group | - |
| Plasmid size | 14114 bp | Coordinate of oriT [Strand] | 9421..9609 [-] |
| Host baterium | Staphylococcus aureus strain A4 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |