Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101908 |
| Name | oriT_MRSN6920|unnamed contig00124  |
| Organism | Klebsiella pneumoniae strain MRSN6920 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JPGS01000124 (1873..1924 [-], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 6..14, 17..25 (CGCAAAATT..AATTTTGCG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT_MRSN6920|unnamed contig00124
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AAATCCGCAAAATTTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2352 | GenBank | NZ_JPGS01000124 |
| Plasmid name | MRSN6920|unnamed contig00124 | Incompatibility group | Col440I |
| Plasmid size | 4419 bp | Coordinate of oriT [Strand] | 1873..1924 [-] |
| Host baterium | Klebsiella pneumoniae strain MRSN6920 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |