Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101906 |
| Name | oriT_MRSN6920|unnamed contig00084  |
| Organism | Klebsiella pneumoniae strain MRSN6920 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JPGS01000084 (1808..1857 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_MRSN6920|unnamed contig00084
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1250..20918
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| HZ19_RS01730 (HZ19_25610) | 34..855 | + | 822 | WP_004178064 | DUF932 domain-containing protein | - |
| HZ19_RS29505 | 888..1217 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| HZ19_RS01725 (HZ19_25615) | 1250..1735 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| HZ19_RS01720 (HZ19_25620) | 2169..2561 | + | 393 | WP_004178062 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| HZ19_RS29510 | 2775..3470 | + | 696 | WP_004178061 | transcriptional regulator TraJ family protein | - |
| HZ19_RS0128100 | 3554..3925 | + | 372 | WP_004208838 | TraY domain-containing protein | - |
| HZ19_RS01710 (HZ19_25635) | 3979..4347 | + | 369 | WP_004178060 | type IV conjugative transfer system pilin TraA | - |
| HZ19_RS01705 (HZ19_25640) | 4361..4666 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| HZ19_RS01700 (HZ19_25645) | 4686..5252 | + | 567 | WP_004152602 | type IV conjugative transfer system protein TraE | traE |
| HZ19_RS01695 (HZ19_25650) | 5239..5979 | + | 741 | WP_004152601 | type-F conjugative transfer system secretin TraK | traK |
| HZ19_RS01690 (HZ19_25655) | 5979..7403 | + | 1425 | WP_004152600 | F-type conjugal transfer pilus assembly protein TraB | traB |
| HZ19_RS01685 (HZ19_25660) | 7396..7992 | + | 597 | WP_004152599 | conjugal transfer pilus-stabilizing protein TraP | - |
| HZ19_RS0128105 | 8015..8584 | + | 570 | WP_004152598 | type IV conjugative transfer system lipoprotein TraV | traV |
| HZ19_RS01680 (HZ19_25665) | 8716..9126 | + | 411 | WP_004152597 | lipase chaperone | - |
| HZ19_RS01675 (HZ19_25670) | 9131..9421 | + | 291 | WP_004152596 | hypothetical protein | - |
| HZ19_RS01670 (HZ19_25675) | 9445..9663 | + | 219 | WP_004171484 | hypothetical protein | - |
| HZ19_RS01665 (HZ19_25680) | 9664..9981 | + | 318 | WP_004152595 | hypothetical protein | - |
| HZ19_RS01660 (HZ19_25685) | 10048..10452 | + | 405 | WP_004152594 | hypothetical protein | - |
| HZ19_RS01655 (HZ19_25690) | 10748..11146 | + | 399 | WP_004153071 | hypothetical protein | - |
| HZ19_RS01650 (HZ19_25695) | 11218..13857 | + | 2640 | WP_004152592 | type IV secretion system protein TraC | virb4 |
| HZ19_RS01645 (HZ19_25700) | 13857..14246 | + | 390 | WP_004152591 | type-F conjugative transfer system protein TrbI | - |
| HZ19_RS01640 (HZ19_25705) | 14246..14872 | + | 627 | WP_004152590 | type-F conjugative transfer system protein TraW | traW |
| HZ19_RS01635 (HZ19_25710) | 14916..15875 | + | 960 | WP_015065634 | conjugal transfer pilus assembly protein TraU | traU |
| HZ19_RS01630 (HZ19_25715) | 15888..16526 | + | 639 | WP_004152682 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| HZ19_RS01625 (HZ19_25720) | 16574..18529 | + | 1956 | WP_004153093 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| HZ19_RS01620 (HZ19_25725) | 18561..18797 | + | 237 | WP_004152683 | conjugal transfer protein TrbE | - |
| HZ19_RS31710 (HZ19_25730) | 18794..18979 | + | 186 | WP_004152684 | hypothetical protein | - |
| HZ19_RS01610 (HZ19_25735) | 19025..19351 | + | 327 | WP_004152685 | hypothetical protein | - |
| HZ19_RS01605 (HZ19_25740) | 19372..20124 | + | 753 | WP_004152686 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| HZ19_RS01600 (HZ19_25745) | 20135..20374 | + | 240 | WP_004152687 | type-F conjugative transfer system pilin chaperone TraQ | - |
| HZ19_RS01595 (HZ19_25750) | 20346..20918 | + | 573 | WP_004152688 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| HZ19_RS01590 (HZ19_25755) | 20911..21232 | + | 322 | WP_024940930 | conjugal transfer protein TrbF | - |
Host bacterium
| ID | 2350 | GenBank | NZ_JPGS01000084 |
| Plasmid name | MRSN6920|unnamed contig00084 | Incompatibility group | - |
| Plasmid size | 21232 bp | Coordinate of oriT [Strand] | 1808..1857 [-] |
| Host baterium | Klebsiella pneumoniae strain MRSN6920 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |