Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101899 |
| Name | oriT_FWSEC0423|unnamed8  |
| Organism | Escherichia coli strain FWSEC0423 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RROS01000136 (24824..25175 [+], 352 nt) |
| oriT length | 352 nt |
| IRs (inverted repeats) | 192..198, 206..212 (TATAAAA..TTTTATA) 40..47, 50..57 (GCAAAAAC..GTTTTTGC) 4..11, 16..23 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 352 nt
>oriT_FWSEC0423|unnamed8
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCCAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAACTCTGGTGTTTCTAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGAGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGCTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGTGCTGCTAGCGGCGCGGTGTGTTTTTTTATAGGATACCGCCAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAACTCTGGTGTTTCTAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 24261..34389
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C9198_RS27405 (C9198_27445) | 20250..20684 | + | 435 | WP_059242517 | conjugation system SOS inhibitor PsiB | - |
| C9198_RS27410 (C9198_27450) | 20681..21443 | + | 763 | Protein_27 | plasmid SOS inhibition protein A | - |
| C9198_RS27855 | 21421..21600 | - | 180 | WP_001309233 | hypothetical protein | - |
| C9198_RS28510 | 21622..21771 | + | 150 | Protein_29 | plasmid maintenance protein Mok | - |
| C9198_RS27415 (C9198_27455) | 21713..21838 | + | 126 | WP_001372321 | type I toxin-antitoxin system Hok family toxin | - |
| C9198_RS27420 (C9198_27460) | 22139..22436 | - | 298 | Protein_31 | hypothetical protein | - |
| C9198_RS27435 (C9198_27475) | 22737..23033 | + | 297 | WP_062895531 | hypothetical protein | - |
| C9198_RS27440 (C9198_27480) | 23144..23965 | + | 822 | WP_062895532 | DUF932 domain-containing protein | - |
| C9198_RS27445 (C9198_27485) | 24261..24770 | - | 510 | WP_001496578 | transglycosylase SLT domain-containing protein | virB1 |
| C9198_RS27455 (C9198_27495) | 25176..25559 | + | 384 | WP_096198444 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| C9198_RS27460 (C9198_27500) | 25746..26435 | + | 690 | WP_000283380 | conjugal transfer transcriptional regulator TraJ | - |
| C9198_RS27465 (C9198_27505) | 26534..26929 | + | 396 | WP_001309237 | conjugal transfer relaxosome DNA-bindin protein TraY | - |
| C9198_RS27470 (C9198_27510) | 26962..27327 | + | 366 | WP_136763423 | type IV conjugative transfer system pilin TraA | - |
| C9198_RS27475 (C9198_27515) | 27342..27653 | + | 312 | WP_024221560 | type IV conjugative transfer system protein TraL | traL |
| C9198_RS27480 (C9198_27520) | 27675..28241 | + | 567 | WP_136763424 | type IV conjugative transfer system protein TraE | traE |
| C9198_RS27485 (C9198_27525) | 28228..28956 | + | 729 | WP_136763425 | type-F conjugative transfer system secretin TraK | traK |
| C9198_RS27490 (C9198_27530) | 28956..30410 | + | 1455 | WP_136763426 | F-type conjugal transfer pilus assembly protein TraB | traB |
| C9198_RS27495 (C9198_27535) | 30400..30960 | + | 561 | WP_097725974 | conjugal transfer pilus-stabilizing protein TraP | - |
| C9198_RS27500 (C9198_27540) | 30947..31267 | + | 321 | WP_222893744 | conjugal transfer protein TrbD | virb4 |
| C9198_RS27505 (C9198_27545) | 31260..31511 | + | 252 | WP_001038341 | conjugal transfer protein TrbG | - |
| C9198_RS27510 (C9198_27550) | 31508..32023 | + | 516 | WP_032210969 | type IV conjugative transfer system lipoprotein TraV | traV |
| C9198_RS27515 (C9198_27555) | 32158..32379 | + | 222 | WP_061873505 | conjugal transfer protein TraR | - |
| C9198_RS27520 (C9198_27560) | 32372..32845 | + | 474 | WP_112033127 | hypothetical protein | - |
| C9198_RS27525 (C9198_27565) | 32925..33143 | + | 219 | WP_000556754 | hypothetical protein | - |
| C9198_RS27530 (C9198_27570) | 33171..33518 | + | 348 | WP_000802783 | hypothetical protein | - |
| C9198_RS27535 (C9198_27575) | 33645..34389 | + | 745 | WP_169072844 | TraC family protein | virb4 |
Host bacterium
| ID | 2343 | GenBank | NZ_RROS01000136 |
| Plasmid name | FWSEC0423|unnamed8 | Incompatibility group | - |
| Plasmid size | 34389 bp | Coordinate of oriT [Strand] | 24824..25175 [+] |
| Host baterium | Escherichia coli strain FWSEC0423 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |