Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101898 |
| Name | oriT_MRSN8157|unnamed contig00090  |
| Organism | Klebsiella pneumoniae strain MRSN8157 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JPGT01000090 (1804..1853 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_MRSN8157|unnamed contig00090
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1246..20914
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| IA58_RS01485 (IA58_25845) | 30..851 | + | 822 | WP_004178064 | DUF932 domain-containing protein | - |
| IA58_RS29440 | 884..1213 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| IA58_RS01480 (IA58_25850) | 1246..1731 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| IA58_RS01475 (IA58_25855) | 2165..2557 | + | 393 | WP_004178062 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| IA58_RS29445 | 2771..3466 | + | 696 | WP_004178061 | transcriptional regulator TraJ family protein | - |
| IA58_RS0128015 | 3550..3921 | + | 372 | WP_004208838 | TraY domain-containing protein | - |
| IA58_RS01465 (IA58_25870) | 3975..4343 | + | 369 | WP_004178060 | type IV conjugative transfer system pilin TraA | - |
| IA58_RS01460 (IA58_25875) | 4357..4662 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| IA58_RS01455 (IA58_25880) | 4682..5248 | + | 567 | WP_004152602 | type IV conjugative transfer system protein TraE | traE |
| IA58_RS01450 (IA58_25885) | 5235..5975 | + | 741 | WP_004152601 | type-F conjugative transfer system secretin TraK | traK |
| IA58_RS01445 (IA58_25890) | 5975..7399 | + | 1425 | WP_004152600 | F-type conjugal transfer pilus assembly protein TraB | traB |
| IA58_RS01440 (IA58_25895) | 7392..7988 | + | 597 | WP_004152599 | conjugal transfer pilus-stabilizing protein TraP | - |
| IA58_RS0128020 | 8011..8580 | + | 570 | WP_004152598 | type IV conjugative transfer system lipoprotein TraV | traV |
| IA58_RS01435 (IA58_25900) | 8712..9122 | + | 411 | WP_004152597 | lipase chaperone | - |
| IA58_RS01430 (IA58_25905) | 9127..9417 | + | 291 | WP_004152596 | hypothetical protein | - |
| IA58_RS01425 (IA58_25910) | 9441..9659 | + | 219 | WP_004171484 | hypothetical protein | - |
| IA58_RS01420 (IA58_25915) | 9660..9977 | + | 318 | WP_004152595 | hypothetical protein | - |
| IA58_RS01415 (IA58_25920) | 10044..10448 | + | 405 | WP_004152594 | hypothetical protein | - |
| IA58_RS01410 (IA58_25925) | 10744..11142 | + | 399 | WP_004153071 | hypothetical protein | - |
| IA58_RS01405 (IA58_25930) | 11214..13853 | + | 2640 | WP_004152592 | type IV secretion system protein TraC | virb4 |
| IA58_RS01400 (IA58_25935) | 13853..14242 | + | 390 | WP_004152591 | type-F conjugative transfer system protein TrbI | - |
| IA58_RS01395 (IA58_25940) | 14242..14868 | + | 627 | WP_004152590 | type-F conjugative transfer system protein TraW | traW |
| IA58_RS01390 (IA58_25945) | 14912..15871 | + | 960 | WP_015065634 | conjugal transfer pilus assembly protein TraU | traU |
| IA58_RS01385 (IA58_25950) | 15884..16522 | + | 639 | WP_004152682 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| IA58_RS01380 (IA58_25955) | 16570..18525 | + | 1956 | WP_004153093 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| IA58_RS01375 (IA58_25960) | 18557..18793 | + | 237 | WP_004152683 | conjugal transfer protein TrbE | - |
| IA58_RS31500 (IA58_25965) | 18790..18975 | + | 186 | WP_004152684 | hypothetical protein | - |
| IA58_RS01365 (IA58_25970) | 19021..19347 | + | 327 | WP_004152685 | hypothetical protein | - |
| IA58_RS01360 (IA58_25975) | 19368..20120 | + | 753 | WP_004152686 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| IA58_RS01355 (IA58_25980) | 20131..20370 | + | 240 | WP_004152687 | type-F conjugative transfer system pilin chaperone TraQ | - |
| IA58_RS01350 (IA58_25985) | 20342..20914 | + | 573 | WP_004152688 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| IA58_RS01345 (IA58_25990) | 20907..21227 | + | 321 | WP_024940930 | conjugal transfer protein TrbF | - |
Host bacterium
| ID | 2342 | GenBank | NZ_JPGT01000090 |
| Plasmid name | MRSN8157|unnamed contig00090 | Incompatibility group | - |
| Plasmid size | 21227 bp | Coordinate of oriT [Strand] | 1804..1853 [-] |
| Host baterium | Klebsiella pneumoniae strain MRSN8157 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |