Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101882
Name   oriT_pCol440I in_silico
Organism   Klebsiella pneumoniae strain CM16_K
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAKKCZ010000048 (904..961 [+], 58 nt)
oriT length   58 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 58 nt

>oriT_pCol440I
GGGTGTCGGGGCGCAGCCCTGAACCAGTCAAGTAGCACGTGCGGAGTGTATACGGGCT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2326 GenBank   NZ_JAKKCZ010000048
Plasmid name   pCol440I Incompatibility group   Col440I
Plasmid size   3913 bp Coordinate of oriT [Strand]   904..961 [+]
Host baterium   Klebsiella pneumoniae strain CM16_K

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -