Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101882 |
| Name | oriT_pCol440I  |
| Organism | Klebsiella pneumoniae strain CM16_K |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAKKCZ010000048 (904..961 [+], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pCol440I
GGGTGTCGGGGCGCAGCCCTGAACCAGTCAAGTAGCACGTGCGGAGTGTATACGGGCT
GGGTGTCGGGGCGCAGCCCTGAACCAGTCAAGTAGCACGTGCGGAGTGTATACGGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2326 | GenBank | NZ_JAKKCZ010000048 |
| Plasmid name | pCol440I | Incompatibility group | Col440I |
| Plasmid size | 3913 bp | Coordinate of oriT [Strand] | 904..961 [+] |
| Host baterium | Klebsiella pneumoniae strain CM16_K |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |