Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101881 |
| Name | oriT_pIncFIBK  |
| Organism | Klebsiella pneumoniae strain FM05_K |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAKJLM010000037 (3066..3115 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pIncFIBK
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2325 | GenBank | NZ_JAKJLM010000037 |
| Plasmid name | pIncFIBK | Incompatibility group | IncFIB |
| Plasmid size | 32469 bp | Coordinate of oriT [Strand] | 3066..3115 [+] |
| Host baterium | Klebsiella pneumoniae strain FM05_K |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |