Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101877
Name   oriT_TS3W|unnamed1 in_silico
Organism   Citrobacter freundii strain TS3W
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JACGFX010000010 (27346..27444 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_TS3W|unnamed1
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2321 GenBank   NZ_JACGFX010000010
Plasmid name   TS3W|unnamed1 Incompatibility group   IncFII
Plasmid size   44593 bp Coordinate of oriT [Strand]   27346..27444 [-]
Host baterium   Citrobacter freundii strain TS3W

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -