Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101875
Name   oriT_pKvUFMG-H10 in_silico
Organism   Klebsiella variicola strain UFMG-H10
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAAVMD020000019 (3515..3574 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pKvUFMG-H10
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCAGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2319 GenBank   NZ_JAAVMD020000019
Plasmid name   pKvUFMG-H10 Incompatibility group   Col440I
Plasmid size   3854 bp Coordinate of oriT [Strand]   3515..3574 [-]
Host baterium   Klebsiella variicola strain UFMG-H10

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -