Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101873 |
| Name | oriT_pIncFIB_Qil  |
| Organism | Klebsiella pneumoniae strain BA29915 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHPLI010000025 (2774..2823 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pIncFIB_Qil
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2317 | GenBank | NZ_JAHPLI010000025 |
| Plasmid name | pIncFIB_Qil | Incompatibility group | IncFIB |
| Plasmid size | 22918 bp | Coordinate of oriT [Strand] | 2774..2823 [+] |
| Host baterium | Klebsiella pneumoniae strain BA29915 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |