Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101869 |
| Name | oriT1_pHKP0064.5  |
| Organism | Klebsiella pneumoniae strain HKP0064 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JACTAR010000008 (3230..3281 [+], 52 nt) |
| oriT length | 52 nt |
| IRs (inverted repeats) | 7..13, 18..24 (GCAAAAT..ATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 52 nt
>oriT1_pHKP0064.5
AAATATGCAAAATGTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
AAATATGCAAAATGTTAATTTTGCGTAGTGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2313 | GenBank | NZ_JACTAR010000008 |
| Plasmid name | pHKP0064.5 | Incompatibility group | Col440I |
| Plasmid size | 8428 bp | Coordinate of oriT [Strand] | 3230..3281 [+]; 7419..7469 [+] |
| Host baterium | Klebsiella pneumoniae strain HKP0064 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |