Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101868 |
Name | oriT_pHKP0064.2 |
Organism | Klebsiella pneumoniae strain HKP0064 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JACTAR010000005 (19208..19306 [-], 99 nt) |
oriT length | 99 nt |
IRs (inverted repeats) | 77..82, 89..94 (AAAAAA..TTTTTT) 77..82, 88..93 (AAAAAA..TTTTTT) 31..38, 41..48 (AGCGTGAT..ATCACGCT) 17..23, 35..41 (TAAATCA..TGATTTA) |
Location of nic site | 59..60 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 99 nt
>oriT_pHKP0064.2
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2312 | GenBank | NZ_JACTAR010000005 |
Plasmid name | pHKP0064.2 | Incompatibility group | IncR |
Plasmid size | 70762 bp | Coordinate of oriT [Strand] | 19208..19306 [-] |
Host baterium | Klebsiella pneumoniae strain HKP0064 |
Cargo genes
Drug resistance gene | aph(3'')-Ib, aph(6)-Id, blaCTX-M-15, qnrS1, blaTEM-1B, aac(3)-IIa, blaOXA-1, aac(6')-Ib-cr, sul1, qacE, dfrA1, tet(A) |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |