Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101839 |
Name | oriT_pECC116-4 |
Organism | Enterobacter hormaechei strain ECC116 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JAIEUB010000005 (20814..20913 [+], 100 nt) |
oriT length | 100 nt |
IRs (inverted repeats) | 78..83, 90..95 (AAAAAA..TTTTTT) 78..83, 89..94 (AAAAAA..TTTTTT) 32..39, 42..49 (AGCGTGAT..ATCACGCT) 18..24, 36..42 (TAAATCA..TGATTTA) |
Location of nic site | 60..61 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pECC116-4
ATTTTGTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
ATTTTGTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2283 | GenBank | NZ_JAIEUB010000005 |
Plasmid name | pECC116-4 | Incompatibility group | - |
Plasmid size | 28880 bp | Coordinate of oriT [Strand] | 20814..20913 [+] |
Host baterium | Enterobacter hormaechei strain ECC116 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |