Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101832
• Name: oriT_ECL415|unnamed22
• Organism: Enterobacter hormaechei strain ECL415
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_JAMYDA010000036 (74..133 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_ECL415|unnamed22
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 2276
• GenBank: NZ_JAMYDA010000036
• Plasmid name: ECL415|unnamed22
• Incompatibility group: -
• Plasmid size: 233 bp
• Coordinate of oriT [Strand]: 74..133 [+]
• Host baterium: Enterobacter hormaechei strain ECL415

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -