Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101827
• Name: oriT_ECL402|unnamed185
• Organism: Enterobacter asburiae strain ECL402
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_JAMYDH010000304 (29..87 [+], 59 nt)
• oriT length: 59 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 59 nt

>oriT_ECL402|unnamed185
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 2271
• GenBank: NZ_JAMYDH010000304
• Plasmid name: ECL402|unnamed185
• Incompatibility group: -
• Plasmid size: 253 bp
• Coordinate of oriT [Strand]: 29..87 [+]
• Host baterium: Enterobacter asburiae strain ECL402

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -