Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101824
Name   oriT_FWSEC0285|unnamed2 in_silico
Organism   Escherichia coli strain FWSEC0285
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRKB01000189 (264..323 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FWSEC0285|unnamed2
GGGTGTCGGGGCGCAGCCATGACCCAGTCACATAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2268 GenBank   NZ_RRKB01000189
Plasmid name   FWSEC0285|unnamed2 Incompatibility group   ColRNAI
Plasmid size   6752 bp Coordinate of oriT [Strand]   264..323 [-]
Host baterium   Escherichia coli strain FWSEC0285

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -